Covid-19

Outline

  1. Covid-19, the Disease
  2. Symptoms
  3. Cause
  4. Transmission
  5. Complication
  6. Tests
  7. Drugs
  8. Masks and Other Measures
  9. Vaccines
  10. SARS-CoV-2, the Virus
  11. Statistics
  12. Covid Fact Checking
  13. History of Pandemics
  14. Med Math
  15. Nucleic Acid, Genes, and Proteins
  16. Politicization
  17. Trump Administration Strategy for Combating the Covid Pandemic

Covid-19, the Disease

Covid-19, the Disease

Symptoms

  • Symptoms of COVID-19 CDC
  • Gasping for Breath
    • A 46 year-old college professor in Argentina experiencing COVID-19 symptoms died after gasping for breath while conducting a Zoom lecture. USA Today
  • Asymptomatic SARS-CoV-2 infection: A systematic review and meta-analysis PNAS

Cause

Transmission

  • SARS-CoV-2 is transmitted by exposure to infectious respiratory fluids CDC

Complications

Covid Pneumonia
  • What Coronavirus Does to the Lungs Johns Hopkins
    • COVID-19 Pneumonia
      • The pneumonia that COVID-19 causes tends to take hold in both lungs. Air sacs in the lungs fill with fluid, limiting their ability to take in oxygen and causing shortness of breath, cough and other symptoms.
    • Acute Respiratory Distress Syndrome (ARDS)
      •  COVID-19 pneumonia can lead to ARDS, a form of lung failure. Patients with ARDS are usually unable to breath on their own, requiring a ventilator.
Long Haul Effects
  • Puzzling, often debilitating after-effects plaguing COVID-19 “long-haulers” 60 Minutes, Nov 22, 2020
    • Doctors are still searching for answers to why a portion of people who were diagnosed with COVID-19 are still suffering symptoms months later.
    • It’s not unusual for viruses to cause aftereffects, but as you’ll hear tonight, doctors tell us they’ve never seen anything like this. While researchers around the world are scrambling to figure out what’s happening, Mount Sinai Hospital here in New York opened one of the first centers to study and treat people with what they’re calling “Post-acute COVID Syndrome.” The patients we met have a less clinical term – they call themselves “long-haulers.”
    • One theory is that the immune system, which was fighting the virus during the infection, is still in overdrive.
  • COVID-19 Can Last for Several Months, Ed Yong Atlantic, June 4, 2020
    • “I interviewed nine of them for this story, all of whom share commonalities. Most have never been admitted to an ICU or gone on a ventilator, so their cases technically count as “mild.” But their lives have nonetheless been flattened by relentless and rolling waves of symptoms that make it hard to concentrate, exercise, or perform simple physical tasks. Most are young. Most were previously fit and healthy. “It is mild relative to dying in a hospital, but this virus has ruined my life,” LeClerc said. “Even reading a book is challenging and exhausting. What small joys other people are experiencing in lockdown—yoga, bread baking—are beyond the realms of possibility for me.”
    • “It’s not clear why this happens. Akiko Iwasaki, an immunologist at Yale, offers three possibilities. Long-haulers might still harbor infectious virus in some reservoir organ, which is missed by tests that use nasal swabs. Or persistent fragments of viral genes, though not infectious, may still be triggering a violent immune overreaction, as if “you’re reacting to a ghost of a virus,” Iwasaki says. More likely, the virus is gone but the immune system, having been provoked by it, is stuck in a lingering overactive state.”
  • Brain Fog Plagues Covid Survivors NYT, October 11, 2020
    • Confusion, delirium and other types of altered mental function, called encephalopathy, have occurred during hospitalization for Covid-19 respiratory problems, and a study found such patients needed longer hospitalizations, had higher mortality rates and often couldn’t manage daily activities right after hospitalization.
    • But research on long-lasting brain fog is just beginning. A French report in August on 120 patients who had been hospitalized found that 34 percent had memory loss and 27 percent had concentration problems months later.
Children
  • Pediatric Data CDC
  • Multisystem Inflammatory Syndrome in Children (MIS-C) CDC

Tests

Tests

Diagnostic Tests

Molecular Test
  • A molecular test (PCR, NAAT) searches the respiratory tract for SARS-Cov-2’s genetic material, strands of its RNA.
  • Nucleic Acid Amplification Tests (NAATs) CDC
Antigen Test
  • Antigen tests search the respiratory tract for antigens of SARS-Cov-2′, e.g the virus’s spike protein.
  • The tests are inexpensive and can be administered at home. Results are available in less than an hour.
  • The tests are less sensitive that PCR tests, i.e. false positives are more likely.
Antibody Test
  • An antibody test (serology test) searches a person’s blood for antibodies to SARS-Cov-2.
  • A positive result means the patient’s had Covid-19 or been vaccinated.

Drugs

New York Times Coronavirus Drug and Treatment Tracker

Anti-Replication Drugs
Remdesivir (FDA approved)
  • A double-blind, randomized, placebo-controlled trial, published in the New England Journal of Medicine, concludes that Remdesivir shortened recovery time from 15 days to 11 days in hospitalized patients.
  • It was developed to fight Ebola, but proved less effective than monoclonal antibody drugs.
  • Remdesivir works by throwing a monkey wrench into the SARS-CoV-2 replication process
Molnupiravir (clinical trials promising)
  • Pronounced mull-new-PEER-a-veer
  • The drug is for people with Covid who are not hospitalized.
  • The pill reduces the risk of hospitalization and death by 50 percent.
  • By contrast, monoclonal antibodies reduce hospitalizations and deaths by 85 percent, but are administered intravenously. 
  • Molnupiravir, a fake piece of RNA, tricks the coronavirus into using it to replicate:
    • A coronavirus invades a human cell, forcing it to make millions of new coronaviruses, using the virus’ RNA.
      • Viruses have genes but can’t make proteins or replicate by themselves.
    • An infected cell absorbs a Molnupiravir molecule.
    • The molecule becomes embedded in the virus’ RNA.
    • The infected cell continues to make new viruses but their RNA is screwed up so they can’t replicate.
  • Molnupiravir and Remdesivir are similar but undermine viral replication differently.
  • Why Merck’s Covid-19 pill molnupiravir could be so important Vox
  • It’s administered as a twice-a-day batch of four pills for five days, compared to other Covid-19 treatments that require expensive intravenous transfusions, such as monoclonal antibodies and convalescent plasma. The antiviral drug remdesivir, currently the only drug with full Food and Drug Administration approval to treat Covid-19, also has to be delivered into the bloodstream.
Antibody Drugs
Monoclonal Antibody Drugs (widely used)
  • Both Convalescent Plasma and Monoclonal Antibody Drugs consist of antibodies. Antibodies of the former come from a donor’s plasma. Antibodies of the latter are clones of a single natural antibody that’s proved especially effective against Covid.
  • Thus, monoclonal antibodies are clones (CLONAL) of a single (MONO) antibody.
  • Regeneron’s REGN-COV2 is mixture of two monoclonal antibodies, REGN10933 and REGN10987, derived from hamster ovary cells.
  • Eli Lilly‘s Bamlanivimab is a recombinant, neutralizing human IgG1 monoclonal antibody (mAb) directed against the spike protein of SARS-CoV-2. It is designed to block viral attachment and entry into human cells, thus neutralizing the virus, potentially treating COVID-19.
Corticosteroids
Dexamethasone (widely used)
  • Steroids can save lives of patients with severe covid-19, earning WHO endorsement (WaPo)
    • Inexpensive steroid drugs reduced the number of deaths in the sickest patients with covid-19, according to three published clinical trials.
    • The World Health Organization, citing evidence from these and similar trials, announced Wednesday it strongly recommends doctors use the medications to combat severe or critical forms of disease caused by coronavirus infections.
    • The WHO review concluded corticosteroids reduced deaths in critically ill patients by 20 percent — a drop from 2 deaths per 5 patients to 1 in 3.
    • Steroids do not attack the virus itself. Instead, they decrease the body’s defensive
Other
Ivermectin
  • The Drug
    • Ivermectin is a prescription drug used for treating parasitic worms.  A form of the medication is used as a horse dewormer.
    • Prescriptions for ivermectin have increased from 3,600 per week before the pandemic to 88,000 per week in August, per  CDC
    • Poison Control Centers Are Fielding A Surge Of Ivermectin Overdose CallsNPR
      • “Of the calls, 75% were from people who bought ivermectin from a feed store or farm supply store and treated themselves with the animal product,” Ashley Webb, director of the Kentucky Poison Control Center, said. The other 25% were people who had a prescription, she added.
  • TOGETHER Study
    • A large double-blind randomized controlled group study published in the New England Journal of Medicine (March 30, 2022) found that Ivermectin does not reduce the risk of being hospitalized with Covid.
      • Ivermectin Does Not Reduce Risk of Covid Hospitalization, Large Study Finds NYT
      • Effect of Early Treatment with Ivermectin among Patients with Covid-19NEJM
        • Patients who had had symptoms of Covid-19 for up to 7 days and had at least one risk factor for disease progression were randomly assigned to receive ivermectin once daily for 3 days or placebo.
        • Relative risk = (100/679)/(111/679) = 0.9
        • P-value = 0.4
  • FDA
    • Why You Should Not Use Ivermectin to Treat or Prevent COVID-19 FDA
    • “You are not a horse. You are not a cow. Seriously, y’all. Stop it.” FDA Tweet
  • NIH
    • NIH Covid-19 Treatment Guidelines nih.gov
      • Recommendation
        • There is insufficient evidence for the COVID-19 Treatment Guidelines Panel (the Panel) to recommend either for or against the use of ivermectin for the treatment of COVID-19. Results from adequately powered, well-designed, and well-conducted clinical trials are needed to provide more specific, evidence-based guidance on the role of ivermectin in the treatment of COVID-19.
  • Conspiracy Theory
    • ‘Sunday Morning Futures’ on impact of censorship in fight against COVID-19 foxnews
      • Excerpt from Maria Bartiromo’s interview with Dr. Pierre Kory
      • BARTIROMO:
        • So, does this boil down to money then, Dr. Kory?
        • I mean, this drug made by Merck, ivermectin, is off-patent. They’re not making any money on it anymore. But now Fauci says he’s looking at a drug that’s going to be a patented drug made by Merck. Aren’t the underlying chemicals the same? So now they’re going to have that on patent, so that they can make a huge profit on it?
      • KORY:
        • Well, that’s — I mean, that is so clearly — it’s a glaring example of the system that we’re in, which is that for-profit medicines are favored, to almost the total exclusion of nonprofit medicines.
        • And so you see all of this money being thrown at pharmaceutical companies to develop new therapies, when we already have existing repurposed drugs that are highly effective. They will never develop a drug that is more effective than ivermectin.
        • I find it absurd. Our government just gave — committed over $4 billion in two different areas this week to try to find an oral antiviral early treatment therapy. We have it now. We can save so many lives.
        • This is a treatable disease. We have identified that drug. And it needs to be systematically deployed throughout the — throughout the health care system.
      • BARTIROMO:
        • Unbelievable.
  • Fact Checks
    • False meme: Nobel laureate did not say ivermectin ‘cures’ covid-19 WaPo Fact Checker
  • Are Judges Doctors?
    • Lawsuits demand unproven ivermectin for COVID patients AP
      • At least two dozen lawsuits have been filed around the U.S. by people seeking to force hospitals to give their COVID-stricken loved ones ivermectin, a drug for parasites that has been promoted by conservative commentators as a treatment despite a lack of conclusive evidence that it helps people with the virus.
  • Civil Rights Violation?
    • Anti-parasite drug used on Arkansas jail’s inmates for COVID AP
      •  Inmates at a northwest Arkansas jail have been prescribed ivermectin to combat COVID-19, despite warnings from federal health officials that the antiparasitic drug should not be used to treat the coronavirus.
      • Washington County’s sheriff confirmed Tuesday night that the jail’s health provider had been prescribing the drug. 
    • Inmates Weren’t Told They Were Given An Anti-Parasite Drug Instead Of COVID-19 Meds NPR
  • Studies
    • The FDA-approved drug ivermectin inhibits the replication of SARS-CoV-2 in vitro, Antiviral Research, June 2020
      • A single treatment is able to effect 5000-fold reduction in virus at 48 h in cell culture.
    • Ongoing Clinical Trials Will Decide Whether (or Not) Ivermectin Is Safe, Effective for COVID-19, Sep 2021 factcheck.org
      • The National Institutes of Health counts over 70 studies evaluating the safety and effectiveness of ivermectin to treat or prevent COVID-19 in humans
      • Two large clinical trials are being conducted in the U.S.
        • The first study, led by the University of Minnesota Medical School, expects to include 1,124 people and will randomly assign patients to six groups, in which every volunteer takes the medications or a placebo at home, twice a day, for 14 days, and then completes a survey. Volunteers must have had a positive COVID test within the prior three days and be between 30 and 85 years old. 
        • The second study, a double-blind randomized phase 3 trial led by the Duke Clinical Research Institute, is evaluating the use of ivermectin, fluvoxamine and fluticasone to reduce symptoms of non-hospitalized volunteers with mild and moderate COVID-19.
      • Researchers in the U.K. are also studying ivermectin.
        • The U.K study has so far recruited over 6,000 volunteers in the United Kingdom. Those receiving ivermectin, people between 18 and 64 years old with underlying conditions or people over 65 with COVID-19, will receive three daily doses of the antiparasitic drug and be followed for 28 days. The results will be compared with patients who received standard care.
    • Is there any evidence ivermectin can treat COVID-19? We analyzed the prominent scientific studies Salon
      • Experts like David Boulware, a professor of medicine at the University of Minnesota’s Medical School and a co-chair of the National Institutes of Health (NIH) ACTIV-6 trial steering committee, say there is definitely not enough scientific evidence to believe that ivermectin is an effective treatment.
      • “The whole problem with all of the ivermectin data is there are a bunch of small studies, that include a dozen of people or a couple dozen people — maybe 100 people — but it’s all very small,” Boulware said. (Indeed, Salon could find no study with even 100 patients.) “There hasn’t really been a large phase three clinical trial, up until the Together Trial, which is the first one.”
      • Boulware was referencing a forthcoming large scientific study out of Brazil. This study, known as the Together Trial, consisted of nearly 2300 participants, and is a Phase 3 randomized, double blind, placebo-controlled trial. While the results have yet to be published or peer-reviewed, they were presented at an Aug. 6 NIH symposium where investigators said ivermectin appeared to have no significant effect on reducing emergency room visits or hospitalizations.
      • Smaller studies, Boulware added, tend to look and see if ivermectin has an impact on a patient’s viral load. Yet there is debate as to whether viral load is a meaningful metric. 
      • Boulware said larger clinical trials are needed to answer more significant questions.
      • “Does it prevent hospitalization? Does it shorten the duration of symptoms? Or lessen symptom severity?” Boulware said. “These larger trials are necessary to define what the clinical benefit is.”
    • What to know about a pro-ivermectin group’s study touting the drug versus COVID-19 Politifact
      • Some limited studies suggested that ivermectin can help treat COVID-19; others show no significant impact. Many of the studies had small sample sizes and other limitations.
      • At the same time, ivermectin has not been universally dismissed as a potential treatment.
      • Meta-analysis supporting ivermectin:
        • Ivermectin for Prevention and Treatment of COVID-19 Infection: A Systematic Review, Meta-analysis, and Trial Sequential Analysis to Inform Clinical Guidelines AJT
          • Conclusion:
            • Moderate-certainty evidence finds that large reductions in COVID-19 deaths are possible using ivermectin. Using ivermectin early in the clinical course may reduce numbers progressing to severe disease. The apparent safety and low cost suggest that ivermectin is likely to have a significant impact on the SARS-CoV-2 pandemic globally.
        • Comments about the study:
          • Some of the studies analyzed in the ivermectin meta-analysis were not peer reviewed, said Dr. David Gorski, a professor of surgery and oncology at Wayne State University and chief of breast surgery at the Karmanos Cancer Institute, who has criticized the June study.
          • “Pooling data from a large number of small, low-quality clinical trials does not magically create one large, high-quality clinical trial,” wrote Gorski, who is also managing editor of Science-Based Medicine, a website that evaluates medical claims. 
      • Meta-analysis casting doubt on ivermectin:
        • Ivermectin for the Treatment of Coronavirus Disease 2019: A Systematic Review and Meta-analysis of Randomized Controlled Trials CID
          • Conclusion:
            • Compared with the standard of care or placebo, IVM did not reduce all-cause mortality, LOS, or viral clearance in RCTs in patients with mostly mild COVID-19. IVM did not have an effect on AEs or SAEs and is not a viable option to treat patients with COVID-19.
    • Flawed ivermectin preprint highlights challenges of COVID drug studies Nature
      • The paper summarized the results of a clinical trial seeming to show that ivermectin can reduce COVID-19 death rates by more than 90% — among the largest studies of the drug’s ability to treat COVID-19 to date. But on 14 July, after internet sleuths raised concerns about plagiarism and data manipulation, the preprint server Research Square withdrew the paper because of “ethical concerns”.

Masks and Other Measures

  • Types of Masks and Respirators CDC
  • Why We Need to Upgrade Our Face Masks—and Where to Get ThemSciAm
    • Mask Nerds recommends KN95s made by Chinese company Powecom and others, a variety of KF94s such as the Bluna FaceFit and N95s made by reputable brands such as 3M, Moldex or Honeywell. 
    • All of these masks had close to 99 percent filtration efficiencies and fairly low pressure drops in Collins’s setup. For comparison, he found that a surgical mask alone had between about 50 and 75 percent filtration efficiency, depending on the fit, and a good cloth mask had about 70 percent.
  • How to Protect Yourself & Others CDC

Vaccines

Overview
  • A vaccine is a substance that stimulates the immune system to develop B-Cells, T-Cells and antibodies that can identify and remember a pathogen, specifically a recognizable part of the pathogen’s surface called an antigen — without making the person sick.
  • It does this in one of two ways:
    • By supplying the body with antigens of the pathogen
      • Whole Virus
        • Bharat Biotech (India)
        • Sinopharm (China)
      • Protein Subunit
        • Novavax
    • By getting the body’s cells to make antigens of the pathogen
      • mRNA
        • Pfizer
        • Moderna
      • DNA / Viral Vector
        • Johnson & Johnson
        • Oxford-AstraZeneca
        • Sputnik V (Russia)
Antigen Vaccines
Whole Virus Vaccines
  • A whole virus vaccine is an ineffective version of the virus itself.
    • Two kinds:
      • Inactivated virus vaccines
        • The vaccine is effectively a dead virus.
      • Live attenuated virus vaccines
        • The vaccine is a live virus, capable of infecting cells, but modified so infection can’t spread.
        • More effective than inactivated vaccines
  • Covid-19 Examples
  • Other Examples
    • Measles, mumps, polio, rubella, tuberculosis
Protein Subunit Vaccines
  • The vaccine consists of antigens of the virus, e.g. spike proteins assembled into a nonoparticle.
  • Covid example
  • Other examples
    • HPV, Hepatitis B
Antigen Gene Vaccines
mRNA Vaccines
  • The vaccine is a strand of messenger RNA that codes for an antigen of the virus, e.g. the spike protein.  Cells absorb the mRNA and make the antigen.
  • Covid examples:
DNA / Viral Vector Vaccines
  • The vaccine is a harmless virus, called a vector, with DNA genes that code for an antigen of the virus, e.g. the spike protein. The vector invades cells, which use the DNA to make antigens.
    • A vector is an agent capable of transmitting a pathogen from one organism to another either mechanically as carrier or biologically by playing a role in the life cycle of the pathogen (Merriam-Webster)
  • A commonly used vector is the adenovirus.
  • Covid examples
New York Times Interactives
  • Coronavirus Vaccine Tracker NYT
  • How Nine Covid-19 Vaccines WorkNYT
Kati Kariko and Drew Weissman won the Nobel Prize for making mRNA vaccines possible
  • For a vaccine to provide immunity against a pathogen, antigens of the pathogen (like the spikes on a coronavirus) need to get inside your body so the immune system can make B Cells, T-Cells, and antibodies able to identify the pathogen and kill it. There are a handful of ways to get antigens into your body.
  • The Pfizer and Moderna vaccines use mRNA.
  • Here’s how these vaccines work
    • mRNA is a piece of RNA with instructions on how to make a protein. The mRNA used in the Pfizer and Moderna vaccines has instructions for making the spike protein of the coronavirus. Once injected, the mRNA molecules are absorbed by healthy human cells. Inside the cells they run into ribosomes, which use the mRNA to make the spike protein of the coronavirus. That triggers the immune system to make white blood cells and antibodies that can identify the coronavirus by its spikes and kill it.
  • Karikó and Weissman published a paper in 2005 that solved a problem that would have prevented mRNA vaccines from working.
  • Halting Progress and Happy Accidents: How mRNA Vaccines Were Made NYT
    • Dr. Drew Weissman, a physician and virologist so taciturn that his family liked to joke he had a daily word limit, was desperate for new approaches to an H.I.V. vaccine.
    • One day in 1998, he was at the copy machine in Penn’s department of medicine when a woman approached him. Katalin Karikó, a 44-year-old scientist from Hungary, was as exuberant as Dr. Weissman was withdrawn. She had no permanent position, no grants and no publications. She was searching for a foothold at Penn, knowing that she would be allowed to stay only if another scientist took her in.
    • Her obsession was mRNA. Defying the decades-old orthodoxy, she believed that it would spur many medical innovations.
    • Conversation at the Xerox machine
      • KK: ‘I am an RNA scientist. I can do anything with RNA,
      • DW: Could you make an H.I.V. vaccine?
      • KK: “Oh yeah, oh yeah, I can do it,”
    • For seven years, the pair studied the workings of mRNA. The problem was that the immune system sees mRNA as a piece of an invading pathogen and attacks it
    • Eventually, they solved the mystery. The researchers discovered that cells protect their own mRNA with a specific chemical modification. So the scientists tried making the same change to mRNA made in the lab before injecting it into cells. It worked: The mRNA was taken up by cells without provoking an immune response.
    • Their paper, published in 2005, was summarily rejected by the journals Nature and Science, Dr. Weissman said. The study was eventually accepted by a niche publication called Immunity.

SARS-CoV-2, the Virus

Viruses
  • A virus is a tiny system of proteins and nucleic acid that can replicate and synthesize proteins only by taking over a cell of an animal, plant, or bacterium.
  • Britannica
    • “Viruses are quintessential parasites; they depend on the host cell for almost all of their life-sustaining functions.”
  • Viruses cause:
    • Influenza, common cold, norovirus, rabies, measles, rubella, chickenpox/shingles, smallpox, hepatitis, polio, mumps, ebola, yellow fever, viral meningitis, SARS, herpes
  • Viruses vs Bacteria
    • Bacteria are self-contained cells, having genes and the ability to make proteins and multiply on their own.
    • Viruses have genes, but are not cells. They replicate by commandeering the machinery of the cells they penetrate.
Structure of SARS-CoV-2
  • SARS-CoV-2, the virus that causes Covid-19, comprises:
    • an oily membrane
    • a strand of RNA
    • four structural proteins:
      • S protein, which forms spikes that attach to the target cell
      • N protein, which forms an envelope around the RNA
      • E and M proteins, which force the target cell to make copies of the virus.
  • The strand of RNA consists of 29,903 nucleotides (named acg ,u):
    • auuaaagguuuauaccuucccagguaacaaaccaaccaacuuucgaucucuuguagaucuguucucuaaacgaacuuuaaaaucuguguggcugucacucggcugcaugcuuagugcacucacgcaguauaauuaauaacuaauuacugucguugacaggacacgaguaacucgucuaucuucugcaggcugcuuacgguuucguccguguugcagccgaucaucagcacaucuagguuucguccgggugugaccgaaagguaag …….
  • The nucleotides make up the virus’ 29 genes.
    • The bacterium E Coli has 4,285 protein-encoding genes.
    • Human beings have 20,000 protein-encoding genes.
  • The virus is spherical with projecting spikes. When a spike comes in contact with an ACE2 receptor on the membrane of a lung cell, the virus locks onto the receptor and penetrates the cell.
Image Credit: Scientific American
Method of Operation
  • How Coronavirus Hijacks Your Cells NYT

After one of its spikes locks onto an ACE2 receptor, the virus breaks into the cell

The virus releases its RNA, which the ribosomes of the infected cell use to make proteins for the virus

New copies of the virus, such as this one, are assembled from the proteins

Thousands of copies of the virus are released, some infecting other cells, others exhaled into the air.

Combating the Immune System
Interfering with Interferons
  • An early immune response to a viral infection is to release interferons, cytokines that try to inhibit the spread of the virus.
  • But at least three SARS-CoV-2 proteins try to hinder the interferon response.
  • If successful and the virus spreads, the immune system may release large numbers of cytokines, creating a cytokine storm, resulting in excessive inflammation.
  • More on Cytokines
  • More on Inflammation
SARS-CoV-2 Genome
  • Bad News Wrapped in Protein: Inside the Coronavirus Genome NYT 

The genes of the coronavirus code for its 29 proteins:

  • Non-structural proteins (16)
    • NSP1 Cellular Saboteur
      • slows down the infected cell’s production of its own proteins.
    • NSP2 Mystery Protein
    • NSP3 Untagging and Cutting
    • NSP4 Bubble Maker
      • helps build fluid-filled bubbles within infected cells.
    • NSP5 Protein Scissors
    • NSP6 Bubble Factory
    • NSP7, NSP8 Copy Assistants
    • NSP9 At the Heart of the Cell
      • infiltrates tiny channels in the infected cell’s nucleus, which holds our own genome.
    • NSP10, NSP16 Genetic Camouflage
      • camouflage the virus’s genes so that they don’t get attacked by the host’s immune system
    • NSP12 Copy Machine
      • duplicates the coronavirus genome
    • NSP13 Unwinding RNA
    • NSP14 Viral Proofreader
      • removes errors made by NSP12, so that the correct letter can be added instead.
  • Structural proteins (4)
    • S Spike Protein
      • forms the spikes extruding from the membrane
    • E Envelope Protein
      • helps force the target cell to make copies of the virus
    • M Membrane Protein
      • helps force the target cell to make copies of the virus
    • N Nucleocapsid Protein
      • forms a long spiral, wrapping and coiling the RNA
  • Accessory proteins (9)
    • ORF3a Escape Artis
    • ORF6 Signal Blocker
    • ORF7a Virus Liberator
    • ORF8 Mystery Protein
    • ORF10 Mystery Protein

Image Credit: Scientific American

Image Credit: NY Times

Variants and Mutations
Mutations
  • Mutations
    • As it replicates SARS-CoV-2 occasionally mutates, each mutation a one-letter change in an RNA strand of 29,903 nucleotides.
    • Many mutations are silent, not affecting synthesized proteins.
    • But some mutations change a protein’s functioning, for better or worse.
      • For example, mutations in the spike protein:
        • help the virus latch on more tightly to human cells
        • help infected cells create new spike proteins more efficiently
        • alter the shape of the spike, helping it evade some antibodies.
  • Variant and Mutation Tracker, NYT
Delta Variant
  • A Calif. elementary school teacher took off her mask for a read-aloud. Within days, half her class was positive for delta. WaPo
    • The Marin County, Calif., elementary school had been conscientious about following covid-19 protocols. Masks were required indoors, desks were spaced six feet apart, and the students kept socially distant. But the delta variant found an opening anyway.
    • On May 19, one teacher, who was not vaccinated against the coronavirus, began feeling fatigued and had some nasal congestion. She dismissed it as allergies and powered through. While she was usually masked, she made an exception for story time so she could read to the class.
    • By the time she learned she was positive for the coronavirus two days later, half her class of 24 had been infected — nearly all of them in the two rows closest to her desk — and the outbreak had spread to other classes, siblings and parents, including some who were fully vaccinated.
    • The case study, published by the Centers for Disease Control and Prevention and highlighted by CDC director Rochelle Walensky during a briefing on Friday, highlights the potential danger for children under the age of 12 — the only group in the United States ineligible for coronavirus vaccines as a hyper-infectious variant tears across the country.

Statistics

Addenda

Covid Fact Checking

Genomic Epidemiology
  • Scientists have a powerful new tool for controlling the coronavirus: Its own genetic codeWaPo
    • In the early days of the pandemic the UK funded a national push to repeatedly decode the coronavirus genome as it made its way across the country. The process reveals tiny, otherwise invisible changes in the virus’s genetic code, leaving a fingerprint that gives scientists valuable glimpses into how the disease is spreading.
    • The practice is called “genomic epidemiology.”
  • Evidence Builds That an Early Mutation Made the Pandemic Harder to Stop, NYT
    • As the coronavirus swept across the world, it picked up random alterations to its genetic sequence. Like meaningless typos in a script, most of those mutations made no difference in how the virus behaved.
    • But one mutation near the beginning of the pandemic did make a difference, multiple new findings suggest, helping the virus spread more easily from person to person and making the pandemic harder to stop.
    • The mutation, known as 614G, was first spotted in eastern China in January and then spread quickly throughout Europe and New York City. Within months, the variant took over much of the world, displacing other variants.

History of Pandemics

Med Math

Excess Deaths
  • Excess deaths = number of actual deaths number of usual deaths.
  • The number of excess deaths is greater than the number of deaths due to Covid.
  • Analysis of Excess Deaths (NYT)
  • Explanations
    • Undiagnosed Covid cases
    • People forgoing or delaying medical care, e.g. for fear of contracting Covid.
Mathematical Modeling
  • IHME Projections
  • COVID-19 Mathematical Modeling CDC
  • Mathematical modeling of infectious disease Wikipedia
  • Compartmental models in epidemiology Wikipedia
  • The SEIR Model Wikipedia
  • SEIR model for COVID-19 dynamics incorporating the environment and social distancing NIH
Fatality Rates
  • Mortality Rate
    • Number of deaths from a disease / Number of people in the population
    • Example
      • 150,000 deaths from Covid / Population of 330,000,000 = 0.000454545
      • 0.000454545 x 100,000 = 45 deaths per 100,000 population
  • Case Fatality Rate
    • Approximate Definition
      • Number of deaths from a disease / Number of diagnosed cases
      • Example
        • 145,000 deaths from Covid / 4,000,000 diagnosed cases of Covid = 3.625%
    • Precise Definition
      • Percentage of people diagnosed with a disease who eventually die from the disease.
        • 200,000 people diagnosed with Covid who eventually die from Covid / 4,000,000 people diagnosed with Covid = 5%
  • Interview with Adam Kucharski, mathematician at the London School of Hygiene & Tropical Medicine (NYT)
    • The case fatality rate measures the risk that someone who develops symptoms will eventually die from the infection.
    • The problem with just dividing the total number of deaths and total number of cases is that it doesn’t account for unreported cases or the delay from illness to death.
  • Mortality Analyses, Johns Hopkins
R0 and Exponential Growth
  • R0 (R-naught)
    • The average number of people who catch the disease from a single infected person (in a population that’s never seen the disease before)
    • If R0 = 2, then: 1 on Day 1, 2 more on Day 2, 4 more on Day 3, 8 more on Day 4, 16 more on Day 5.
    • NY Times
    • The Atlantic
  • Doubling Time
    • Time it takes a population to double
    • Current doubling time for infections in US is 20 days.
  • Growth
    • Arithmetic Growth, Example (Blue)
      • For each number n, the following number is n + 3
      • = {1, 4, 7, 10, 13, 16, 19, 22}
    • Exponential Growth, Example (Orange)
      • {30 , 31 , 32 , 33 , 34 , 35 , 36}
      • = {1, 3, 9, 27, 81, 243, 729}
Regular Plot

Log Plot

Vaccine Efficacy and Effectiveness
  • Vaccine efficacy and effectiveness measure how much a vaccine reduces the risk of getting sick (or being hospitalized or dying)
    • Vaccine efficacy is computed for the results of a randomized controlled study, e.g. phase III of a clinical trial.
    • Vaccine effectiveness is computed for the results of an observational study.
  • Vaccine efficacy / effectiveness is the percent change in the risk of getting sick, from being unvaccinated to being vaccinated.
  • The general formula for percent change is:
  • The formula for vaccine efficacy / effectiveness reverses the old and new values in the numerator, since the interest is reduction:
    • VE = (risk of getting sick when unvaccinated – risk of getting sick when vaccinated) / risk of getting sick when unvaccinated
  • Example:
    • Suppose of 10,000 unvaccinated people 1000 get sick; and of 5,000 vaccinated people 50 get sick.
    • The risk of getting sick if you’re unvaccinated is 1000 / 10,000 = 10 percent.
    • The risk of getting sick if you’re vaccinated is 50 / 5,000 = 1 percent
    • So the vaccine reduced the risk of getting sick from 10 percent to 1 percent, a reduction of 9 percentage points.
    • That’s a percent reduction of 90%
      • (10 –1) / 10 = 0.9 = 90%
  • VE runs from 0% to 100%
    • If the vaccinated risk = the unvaccinated risk, VE = 0%
      • For example, (10 – 10) / 10 = 0
    • If the vaccinated risk is half the unvaccinated risk, VE = 50%
      • For example, (10 – 5) / 10 = 1/2
    • If the vaccinated risk = 0 and the unvaccinated risk > 0, VE = 100%
      • For example, (10 – 0) / 10 = 1
  • Computing the efficacy of the Pfizer vaccine based on a randomized controlled study in Europe (EMA).
    • Subjects were randomized into a vaccine group and a control group (who received a placebo)
    • Results:
      • 8 of 17,411 receiving the vaccine got sick
      • 162 of 17,511 receiving the placebo got sick
    • So the vaccine efficacy is
      • ((162/17511) – (8/17411)) / (162/17511) = 0.950334 = 95 percent
        • The 95% credible interval is 90.3 percent to 97.6 percent, that is, there’s a 95% probability that the vaccine efficacy is between 90.3 and 97.6 percent.
    • Note
      • Some randomized controlled studies of vaccine efficacy are human challenge trials, where everyone in both vaccine and control groups are purposively exposed to the pathogen.
      • In the majority of Covid vaccine studies subjects are exposed to the pathogen only if they encounter it in the normal course of their lives.
  • Computing the effectiveness of the Pfizer vaccine based on an observational study in Israel (NEJM)
    • Subjects were divided into
      • vaccinated group with 596,618 subjects
      • unvaccinated group with 596,618 subjects
    • Each vaccinated person was matched to an unvaccinated subject based on:
      • age, sex, neighborhood of residence, history of influenza vaccination, pregnancy, total number of coexisting risk conditions
    • Result
      • 5657 of the unvaccinated group developed symptomatic Covid compared to 339 in the vaccinated group group
    • Effectiveness of vaccine:
      • ((5657 / 596618) – (339 / 596618)) / (5657/596618) = 94%
    • Comment from study:
      • “As with any observational study, our study may have been affected by residual confounding due to differences between vaccinated persons and unvaccinated controls, especially in terms of health-seeking behavior. We therefore performed rigorous matching on a wide range of factors that may be expected to confound the causal effect of the vaccine on the various outcomes. After the matching process, we found a consistent pattern of similarity between the groups…”
Percent Change versus Change in Percentage Points
Sensitivity, Specificity, Positive and Negative Predictive Values
  • A drug company develops a test for Covid. It tests the test by testing 2,061 subjects, 53 with Covid.  The results are:
    • positive for 52 of the 53 with Covid
    • negative for 1999 of the 2008 without Covid
  • The results displayed in a grid:
    • True positives and true negatives are in green. False positives and false negatives are in red.
  • The results provide two standard measures for evaluating a test:
    • The sensitivity of the test is the probability of a positive result given that the subject is sick, in this case 52 / 53 = 98.11%.
    • The specificity is the probability of a negative result given that the subject is not sick, in this case 1999 / 2008 = 99.55%
  • That is, using the notation of conditional probability:
    • Sensitivity = P(positive | sick) = 98.11%
    • Specificity = P(negative | not sick) = 99.55%.
    • View Conditional Probability
  • The test results can also be used to calculate the positive and negative predictive values:
    • The probability you have Covid if you test positive:
      • Positive Predictive Value = P(sick | positive) = 85.25%
    • The probability you don’t have Covid if you test negative:
      • Negative Predictive Value = P(not sick | negative) = 99.95%
  • Suppose you test positive for Covid in the real world. What’s the probability you have Covid?
    • The Positive Predictive Value calculated on the test results = 85.25%. But that calculation was based on 2.57% of test subjects having Covid (53 out of 2061). The prevalence of Covid may have changed since then.
  • Suppose the prevalence of Covid in the population is now 1%.  The Positive Predictive Value (PPV) can be recalculated using Bayes Theorem given the specificity and sensitivity of the test and the updated prevalence of Covid.
    • P(sick | positive) = P(sick) x P(positive | sick) / (P(sick) x P(positive | sick) + P(not sick) x P(positive | not sick))
    • 0.688586 = (0.01 x 0.981132) /( (0.01 x 0.981132) + (1 – 0.01) x (1 – 0.995518) )
    • That is, P(sick | positive) = 68.86%

Online Test Analysis Calculator

Nucleic Acid, Genes, and Proteins

  • A nucleic acid (RNA or DNA) is a molecule consisting of a long sequence of nucleotides, e.g. the RNA molecule:
    • acuuaagcuuucgggugaguguacugcccacuccuagcuuuccuuuaguucuuagacgagcuggcgcguagauggcuacgugacuugaaugcauuagugucuagaugcauuauggaaccauuccaaucgucucggagggcuagugcugccaucuugguuaugugguaucgugauuugaaucaguccagcgcuauaaagucuuacuuaagcuuucgggugaguguacuauggcccacucccuuuccuuuuaggacugacgaccgcagaggccac
  • The RNA nucleotides are: a, c, u, g
  • The DNA nucleotides are: a, c, t, g
  • A protein is a molecule, consisting of a chain of amino acids, that performs a specific function. Proteins include hormones, antibodies, and enzymes
  • Proteins and nucleic acids are among the four chemical building blocks of life: carbohydrates, lipids, proteins, nucleic acids.
  • A gene is a segment of a nucleic acid that “codes for” a protein, providing the blueprint for its synthesis.
  • For example, the hypothetical gene [auggcc cac ucc cuu ucc uuu uag] codes for the protein defined by the amino acid sequence: A, H, S, L, S, F:
    • aug = beginning of gene
    • gcc A
    • cac H
    • ucc S
    • cuu L
    • ucc S
    • uuu F
    • uag = end of gene
  • Each 3-member sequence of a, u, g, c is a codon.
    • The codon aug signifies the start of a protein.
    • The codon uag is one of three codons that mark the end of a protein.

Politicization

Masks in Schools
  • Mask Mandates and Guidance for Schools in Each State, NYT
  • Click here for most recent map
CDC
  • Guidance for COVID-19 Prevention in K-12 Schools CDC
    • Due to the circulating and highly contagious Delta variant, CDC recommends universal indoor masking by all students (age 2 and older), staff, teachers, and visitors to K-12 schools, regardless of vaccination status.
Effectiveness of Masks
  • The Masks Were Working All Along 9/4/2021 Atlantic
    • This week, a group of scientists from Yale, Stanford, UC Berkeley, and other institutions published the final results of a randomized study of community-wide masking behavior in Bangladesh.
    • The study encompassed roughly 350,000 people in 600 villages. The researchers randomly selected certain villages for an intervention that included giving out free masks, paying villagers to remind people to cover their face, and having village leaders and religious figures such as imams emphasize the importance of masks. The researchers also paid villagers to count properly worn masks in public places, including markets and mosques. To gather data on coronavirus transmission, the team asked about symptoms and conducted blood tests to determine who came down with COVID-19 over the course of the study.
    • The randomly assigned pro-masking policy
      • increased mask wearing from 14 to 43 percent in the intervention group
      • reduced the number of confirmed, symptomatic COVID-19 cases in the intervention group by nearly 10 percent, relative to the control group.
    • The study also found clear evidence that surgical masks are better at reducing the spread of symptomatic COVID-19 than cloth masks.
Iowa
  • A judge blocked Iowa from enforcing its ban on school mask mandates. 9/13/2021 NYT
    • Senior Judge Robert W. Pratt, in explaining his decision to issue a temporary restraining order, said that “if the drastic increase in the number of pediatric Covid-19 cases since the start of the school year in Iowa is any indication of what is to come, such an extreme remedy is necessary to ensure that the children involved in this case are not irreparably harmed.”
    • But Gov. Kim Reynolds, a Republican, said the ruling trampled on parental rights and suggested that the court fight was far from over.
    • “Today, a federal judge unilaterally overturned a state law, ignored the decision by our elected legislature and took away parents’ ability to decide what’s best for their child,” Ms. Reynolds said in a statement. 
  • Reynolds’ argument:
    • Parents have the right to decide what’s best for their children.
    • Therefore parents have the right to decide whether their children attend school with or without a mask.
Florida
  • Ron DeSantis
    • “We should protect the freedoms and statutory rights of students and parents by resting with the parents the decision whether their children should wear masks in school.”
  • Florida court rejects effort by Gov. Ron DeSantis to ban mask mandates, 8/27/2021 NYT
    • In a lengthy ruling from the bench, Judge Cooper sided with parents of students in various school districts who had argued that Florida’s Constitution requires keeping schoolchildren safe and secure, and masks would help accomplish that in a pandemic.
    • Lawyers for Mr. DeSantis, a Republican, and the Florida Department of Education had countered that a “parents’ bill of rights” enacted by state lawmakers earlier this year gave parents the right to decide if their child should wear a mask. Judge Cooper disagreed, saying the new law “doesn’t ban mask mandates” and in fact gives school districts the discretion to impose them.
  • Florida judge rules against DeSantis again, allows schools to require masks 9/8/2021 WaPo
    • A Florida judge on Wednesday ruled against Gov. Ron DeSantis’s administration for a second time over school mask mandates, allowing school boards to require that students wear face coverings
  • An appeals court backs DeSantis, 9/10/2021 WaPo
    • An appeals court sided with Gov. Ron DeSantis, reinstating his ban on mask mandates in public schools. The court’s ruling reversed a decision by Leon County Circuit Judge John C. Cooper that had temporarily allowed school districts to enforce their mask rules as the court looks at the substance of the case.
Texas
  • Texas school district adds masks to dress code, finding possible loophole in Abbott’s ban 8/18/2021 WaPo
    • The Paris Independent School District announced Tuesday that the district of about 4,000 students would include the masks in the dress code after its board of trustees expressed “concerned about the health and safety of its students and employees.” The district, located about 110 miles northeast of Dallas, noted that Abbott’s executive order last month did not suspend a chapter in the Texas Education Code that gives school districts power to oversee health and safety measures, thus allowing Paris ISD officials to elect to “amend its dress code consistent with its statutory authority.”
    • “The Board believes the dress code can be used to mitigate communicable health issues,” the district said in a statement. “The Texas Governor does not have the authority to usurp the Board of Trustees’ exclusive power and duty to govern and oversee the management of the public schools of the district.”
    • “For health reasons, masks are required for all employees and students to mitigate flu, cold, pandemic, and any other communicable diseases,” the measure reads.
  • Texas school districts mask up following covid deaths of two middle school teachers 9/7/2021 WaPo
    • When classes began a couple of weeks ago, before the first and then the second teacher at Connally Junior High School died of covid-19, only a scattering of students wore masks. On Tuesday morning, every face emerging from the line of yellow school buses was covered.
    • Masks are now mandatory for students and staff in the Connally Independent School District, on the outskirts of Waco. The decision, made late last week, followed the two teacher deaths and a surge of cases in the community.
    • “As educators, it is our duty to keep our students safe and healthy. We feel instituting a mask mandate is a step towards doing this,” Superintendent Wesley Holt said in a letter to parents.
  • Texas sues six school districts that issued mask mandates in defiance of Gov. Greg Abbott’s order 9/10/2021 TexTrib
    • For the first time in the Texas mask wars, Attorney General Ken Paxton is suing six school districts that have defied Gov. Greg Abbott’s ban on local masking orders.
    • Paxton on Friday sued the Elgin, Galveston, Richardson, Round Rock, Sherman and Spring school districts for requiring students, teachers, school employees and visitors to don face coverings while on their premises. It was not immediately clear late Friday why Paxton chose the six districts he sued.
  • Texas AG Paxton sues more districts, including Paris ISD, which incorporated masks into dress code, 9/142021 DMN
    • Texas Attorney General Ken Paxton announced it filed suit against nine more school districts, including Waco and Paris ISDs. In August, Paris — a 3,800-student district about 100 miles northeast of Dallas — added masks as part of the school’s dress code “to address health issues in light of [the] pandemic.”
Biden Administration
  • Biden administration opens civil rights investigations over bans on school mask mandates 8/30/2021 WaPo
    • The Education Department opened civil rights investigations Monday into five states for policies banning school districts from requiring masks
    • Letters were sent to education officials in Iowa, South Carolina, Utah, Oklahoma and Tennessee, all of which bar local districts from mandating masks. They allege that these states may be preventing districts from meeting the needs of students with disabilities who are at heightened risk for severe illness should they contract the coronavirus.
  • Florida school mask fights heat up again as Biden administration opens civil rights investigation, 9/10/2021 WaPo
    • The Education Department said Friday it is investigating whether Florida was violating the rights of students with disabilities by preventing school districts from requiring masks.
    • The department has opened similar probes in Iowa, Oklahoma, South Carolina, Tennessee and Utah.
Supreme Court
  • Prince v. Massachusetts (1944)
    • In Prince v. Massachusetts the Supreme Court held that the government has broad authority to regulate the actions and treatment of children. Parental authority is not absolute and can be permissibly restricted if doing so is in the interests of a child’s welfare.
    • From the ruling by Justice Wiley Rutledge
      • “And neither rights of religion nor rights of parenthood are beyond limitation. Acting to guard the general interest in youth’s well being, the state as parens patriae may restrict the parent’s control by requiring school attendance, regulating or prohibiting the child’s labor, and in many other ways. Its authority is not nullified merely because the parent grounds his claim to control the child’s course of conduct on religion or conscience. Thus, he cannot claim freedom from compulsory vaccination for the child more than for himself on religious grounds. The right to practice religion freely does not include liberty to expose the community or the child to communicable disease or the latter to ill health or death.”
Arguments

Should it be up to school officials or each parent whether students wear masks at school?

  • Reynolds’ argument:
    • Parents have the right to decide what’s best for their children.  So parents have the right to decide whether their children attend school with or without a mask.
  • Police Power
    • In constitutional law, police power consists of the rights and powers of a state to promote and maintain the general welfare of the state, including public health, public morals, and public safety. Police power may restrict individual liberties, e.g. requiring that students be vaccinated.
  • Duty to protect
    • School administrators have a duty to protect the safety and health of their students.  They may therefore require masks in a pandemic.
  • Parental rights not absolute
    • Parental rights are not absolute, but can be limited by the state to protect the safety and health of their children and to protect the safety and health of others.
    • The state thus has the right to protect students within its jurisdiction by requiring masks in schools.
  • Rights don’t extend to putting at risk
    • Parents have the right to decide what’s best for their children. But that does not extend to risking the safety and health of other parents’ children.
  • Analogy with Dress Code
    • Parents have the right to decide what’s best for their children. Therefore they have the right to send their children to school in skimpy bathing suits.
    • School administrators have the right to impose a dress code and therefore prohibit skimpy bathing suits.
Mandatory Vaccinations for government employees and contractors, business employees and customers, teachers and students, health care workers, military personnel, travelers, state residents
Current Situation
Vaccine Effectiveness
  • Unvaccinated Americans are 11 times more likely to die of Covid, the C.D.C. reports. NYT
    • Three studies that drew data from different U.S. regions evaluated the protective power of the vaccines. One looked at more than 600,000 virus cases in 13 states, representing about one quarter of the U.S. population, between April and July, and concluded that individuals who were not fully vaccinated were far more susceptible to infection and death from the virus.
    • They were 4.5 times more likely than vaccinated individuals to become infected, 10 times more likely to be hospitalized, and 11 times more likely to die from the coronavirus, the study found.
    • Vaccine protection against hospitalization and death remained strong even when the Delta variant was the dominant form of infection. But the vaccines’ effectiveness in preventing infection dropped from 91 percent to 78 percent, the study found.
Biden’s Vaccination Mandates
  • From Path out of Pandemic, Paraphrased (whitehouse.gov/covidplan/)
    • Employers with 100+ Employees
      • The Occupational Safety and Health Administration (OSHA) is developing a rule that requires all employers with 100 or more employees to ensure their workforce is fully vaccinated or require unvaccinated workers to get a negative result on a weekly Covid test before coming to work. OSHA will issue an Emergency Temporary Standard (ETS) to implement the rule. This requirement will affect over 80 million workers in the private sector.
      • OSHA is also developing a rule requiring employers with 100+ employees to provide paid time off for workers to get vaccinated or to recover from the shot
    • Federal Workers and Contractors doing business with the Federal Government
      • The President has signed executive orders requiring that all federal executive branch workers be vaccinated and all employees of contractors that do business with the federal government. 
      • The Department of Defense, the Department of Veterans Affairs, the Indian Health Service, and the National Institute of Health will complete implementing their previously announced vaccination requirements, covering 2.5 million people.
    • Health Care Workers at Hospitals participating in Medicare and Medicaid
      • The Centers for Medicare & Medicaid Services (CMS) will require COVID-19 vaccinations for workers in most health care facilities receiving Medicare or Medicaid reimbursement, including hospitals, dialysis facilities, ambulatory surgical settings, and home health agencies. 
      • This action is in addition to the vaccination requirement for nursing facilities, applying to nursing home staff as well as staff in hospitals and other CMS-regulated facilities
Levels of Mandate
  • Get vaccinated or
    • be tested weekly
    • pay a fine
    • your insurance premium goes up
    • get fired
    • you won’t be allowed in school
    • be quarantined
    • be forcibly vaccinated
  • Get vaccinated or be tested weekly:
    • “For starters, this is not a ‘vaccine mandate.’ It is a requirement that employees either get vaccinated or subject themselves to weekly testing.” Jennifer Rubin WaPo
    • “You could even call it a testing mandate with a vaccination opt-out, if you wanted to.”Aaron Blake WaPo
OSHA
  • Legal Justification for ETS
    • “The Secretary shall provide for an Emergency Temporary Standard to take immediate effect upon publication in the Federal Register if he determines
      • that employees are exposed to grave danger from exposure to substances or agents determined to be toxic or physically harmful or from new hazards, and
      • that such an emergency standard is necessary to protect employees from such danger.”
    • The delta variant of the SARS-CoV-2 virus is a substance or agent that is physically harmful.
    • Employees are exposed to grave danger from exposure to the delta variant of SARS-CoV-2.
    • Requiring employees to be vaccinated or tested weekly is necessary to protect employees from the delta variant of the SARS-CoV-2 virus.
  • Biden’s Authority to Mandate Vaccines Stems From Law Protecting Workers From ‘Grave Dangers’ NYT
    • Once the regulations are in place, OSHA will enforce them using the usual tools provided to the agency: They will collect reports of violations and will send inspectors out to businesses. And for those businesses that refuse to enact the rules, the agency can impose $13,600 fines for minor violations and $136,000 for major ones.
  • Biden’s covid order for big employers isn’t unconstitutional. It’s ordinary. Jennifer Rubin WaPo
    • In June OSHA issued an Emergency Temporary Standard for health-care workers that required measures to suppress transmission of Covid-19 including
      • patient screening and management;
      • Standard and Transmission-Based Precautions;
      • personal protective equipment (PPE), including face masks or respirators;
      • controls for aerosol-generating procedures;
      • physical distancing of at least six feet, when feasible;
      • physical barriers;
      • cleaning and disinfection;
      • ventilation;
      • health screening and medical management;
      • training;
      • anti-retaliation;
      • record-keeping; and reporting.
    • OSHA regulates hazards that do not appear only or even primarily in workplaces. Everything from tuberculosis and hepatitis B protocols to bloodborne pathogens to Ebola falls within the so-called general duty clause, which states that “[e]ach employer shall furnish to each of his employees employment and a place of employment which are free from recognized hazards that are causing or are likely to cause death or serious physical harm to his employees.”
  • Are Biden’s new vaccine requirements legal? Ian Millhiser Vox
    • While Occupational Safety and Health Act  gives the department a great deal of power to issue regulations, it normally may only do so in a lumbering, protracted process that typically takes years to complete. According to the nonpartisan Congressional Research Service, the whole process, on average, takes seven years and nine months — meaning that, if the Biden administration started that process now in order to push out a vaccination rule, President Biden could be out of office by the time that rule is finalized.
    • The law also has a rarely invoked a provision permitting OSHA to bypass this long process and issue an Emergency Temporary Standard, which may remain in place for up to six months. Although this provision has not been used very often in the past, the Biden administration did use it last June to implement new, Covid-related rules governing health care employers.
    • Prior to the pandemic, the last time OSHA attempted to issue an Emergency Temporary Standard was 1983, when the Reagan administration tried to reduce the amount of asbestos workers could be exposed to by 75 percent. That rule was eventually struck down by the United States Court of Appeals for the Fifth Circuit, although on fairly narrow grounds, and in an opinion that suggests OSHA has a fair amount of discretion to decide when an emergency standard is warranted.
Supreme Court Decisions
  • Police Power
    • In constitutional law, police power consists of the rights and powers of a state to promote and maintain the general welfare of the state, including public health, public morals, and public safety. Police power may restrict individual liberties, e.g. requiring that students be vaccinated.
  • Jacobson v. Massachusetts (1905)
    • In Jacobson v. Massachusetts the Supreme Court upheld the authority of states to enforce compulsory vaccination laws
    • From the ruling by Justice John Marshall Harlan
      • “Upon the principle of self-defense, of paramount necessity, a community has the right to protect itself against an epidemic of disease which threatens the safety of its members.”
      • “But the liberty secured by the Constitution of the United States to every person within its jurisdiction does not import an absolute right in each person to be, at all times and in all circumstances, wholly freed from restraint.”
      • Real liberty for all could not exist under the operation of a principle which recognizes the right of each individual person to use his own [liberty], whether in respect of his person or his property, regardless of the injury that may be done to others.”
    • A state can thus protect public health by taking action that restricts individual liberty.
  • Supreme Court won’t block Indiana University vaccine mandate as Justice Barrett rejects student pleaWaPo
    • The lower courts relied on a Supreme Court precedent from 1905. In Jacobson v. Massachusetts, the court backed a government requirement that people get vaccinated against smallpox or pay a fine.
  • Zucht v. King (1922)
    • In Zucht v. King the Supreme Court ruled that a school district could prohibit unvaccinated students from attending school.
Greg Abbott
  • Gov. Greg Abbott bans government mandates on COVID-19 vaccines regardless of whether they have full FDA approvalTexTrib
    • Abbott’s latest order is simple, saying “no governmental entity can compel any individual to receive a COVID-19 vaccine.” The order preserves exceptions for places like nursing homes and state-supported living centers.
    • Private businesses are still banned from requiring vaccination proof from customers under the new state law, Senate Bill 968.
    • Neither Abbott’s latest order nor the law address vaccine requirements for private business employees.
Partisan Divide
  • Vaccination Mandates Are an American Tradition. So Is the Backlash NYT
    • One thing distinguishes today’s anti-vaccination protesters from those of the past. The opposition was always political. It wasn’t always partisan.
    • “There are plenty of echoes today: There are liberty claims, there are strong sentiments about parental rights, there are concerns about the science, there are concerns about the profit involved,” Professor Willrich said. “But this party divide in terms of who is most likely to be hesitant or refuse a vaccine mandate is really, I think, something of our own 21st-century moment.”

Image Credit The undeniable overlap of politics, vaccinations, and the impact of the virus’s fourth wave, Philip Bump WaPo

Polls
  • More than half of Americans support vaccine mandates for workplaces, classrooms and sporting events CNN
  • White House’s COVID-19 Vaccination Mandates Have the Support of About 3 in 5 Americans Morning-Consult
  • Three in five Americans support new Biden administration vaccine mandates Ipsos
Argument by Analogy
  • Not requiring vaccinations is analogous to legalizing drunk driving
    • Deaths
      • About 10,000 people die per year in impaired-driving accidents in the U.S.
      • More than 650,000 Americans have died from Covid so far
    • Risk
      • Being vaccinated reduces the risk of getting sick by a factor of 5 and of death by a factor of 11.
      • Driving sober reduces the risk of a crash by a factor of 14.
    • Risk to Others
  • Derived from Remaining unvaccinated in public should be considered as bad as drunk driving, by Leana S. Wen and Sam Wang WaPo
Why is it okay to require vaccinations for school children but not okay to require them for workers?
  • Mississippi’s governor criticizes Biden’s vaccine mandate while suggesting people vaccinate Politico
    • CNN’s Jake Tapper pushed back on Reeves to point out that the governor himself has received the vaccine and the state has historically required vaccines, for example, in schools.
    • “The Mississippi Legislature has enacted laws for many years regarding vaccines of many types. It is unique to kids and their ability to go to our public schools. It’s not vaccines mandated in the workplace,” Reeves said. “This is an attack by the president on hardworking Americans and hardworking Mississippians who he wants to choose between getting a jab in their arm and their ability to feed their families.”
Vaccine Passports
  • What Are the Roadblocks to a ‘Vaccine Passport’?NYT
    • Currently, Americans are issued a white paper card as evidence of their Covid-19 shots, but these can easily be forged, and online scammers are already selling false and stolen vaccine cards.
    • While the federal government has said it will not introduce digital vaccine passports by federal mandate, a growing number of businesses — from cruise lines to sports venues — say they will require proof of vaccinations for entry or services. 
    • Governments, technology companies, airlines and other businesses are testing different versions of digital health passes and trying to come up with common standards so that there is compatibility between each system and health records can be pulled in a safe and controlled format.
    • Examples
      • In March, New York became the first state to launch a digital health certificate called Excelsior Pass, which verifies a person’s negative coronavirus test result and if they are fully vaccinated.
        • The app and website, which has now had more than one million downloads, is free and voluntary for all New York residents, and provides a QR code that can be scanned or printed out to verify a person’s health data. The pass has been used by thousands of New Yorkers to enter Yankee Stadium, Madison Square Garden and other smaller public venues.
        • Most businesses require people to show their state I.D. along with their Excelsior Pass to prevent potential fraud.
      • In Israel, where more than half the population is fully vaccinated, residents must show an electronic “Green Pass” to attend places such as gyms, concerts, wedding halls and to dine indoors.
      • The European Union has endorsed an electronic vaccine certificate to be recognized from July 1, which a number of European countries have begun using, but each individual member country will be able to set its own rules for travel requirements. Britain has also started testing a Covid-19 certificate system that aims to help businesses reopen safely.
      • Some airlines including Lufthansa, Virgin Atlantic and Jet Blue have started to use the digital health app, Common Pass, to verify passenger Covid-19 test results before they board flights. The International Air Transport Association’s Health Pass is being used by more than 20 airlines and allows passengers to upload health credentials necessary for international travel.
    • The Biden administration has said there will be no federal vaccination system or mandate. 
    • Individual states hold primary public health powers in the United States and have the authority to require vaccines.
    • Banning Vaccine Passports
      • In April, Gov. Greg Abbott of Texas issued an executive order banning government agencies, private businesses and institutions that receive state funding from requiring people to show proof that they have been vaccinated against the coronavirus.
      • Ron DeSantis, the Florida governor, issued a similar order, saying that requiring proof of vaccination would “reduce individual freedom” and “harm patient privacy” as well as “create two classes of citizens based on vaccinations.”
      • But those orders may not stick. “The governors are on shaky legal ground,” said Lawrence Gostin, the director of the O’Neill Institute for National and Global Health Law at Georgetown University. “Certainly, the legislature has authority to regulate businesses in the state, and it can also preempt counties and local governments from issuing vaccine passports. But a governor, acting on his or her own, has no inherent power to regulate businesses other than through emergency or other health powers that the legislature gives them.”
    • Where will the information come from?
      • In the United States, there is no centralized federal vaccine database. Instead, the states collect that information. All states except New Hampshire have their own immunization registries and some cities, like New York, have their own.
      • Currently states are required to share their registries with the Centers for Disease Control and Prevention, but the data is not public and could be withheld.
      • That means anyone developing a digital vaccine certificate in the United States would have to obtain immunization data from individual states, which could be problematic in states that oppose health pass initiatives.
  • Which States Ban or Require Vaccine Passports USA News

Trump Administration Strategy for Combating the Covid Pandemic

  • The Trump Administration strategy:
    • Issue optional, qualitative guidelines
    • Put states in charge of managing the response.
White House Guidelines
  • These guidelines are optional, for example:
    • The guidelines say that before moving to a less rigorous “phase” of the guidelines, there should be a downward trajectory of documented cases or percentage of positive tests within a 14-day period. These are called the Gating Criteria.
    • But most states reopened without meeting the downward trajectory guideline.
      • Most States That Are Reopening Fail to Meet White House Guidelines (NYT)
      • Assessment of States per White House metrics (ProPublica)
  • Except for the Gating Criteria the guidelines are qualitative, for example:
    • States should have the “ability to test Syndromic/ILI-indicated persons for COVID and trace contacts of COVID+ results”
      • ILI = influenza-like illness
  • Versus a quantitative requirement such as:
    • There should be at least 150 daily tests per 100,000 people. (Vox)
States’ Managing the Response
  • State responses differ, e.g. regarding:
    • Whether Covid-19 should be under control before reopening
    • Whether wearing masks in public is mandatory
    • Which businesses may be open
    • Whether schools are in-person or virtual
    • Under what conditions a school close must close
    • What constitutes an outbreak
    • What data to collect and report
    • Whether to allow crowded events, e.g. the Sturgis Motorcycle Rally.
  • In the U.S., states — not science — decide what counts as a coronavirus outbreak (WaPo. October 7, 2020)
    • The nation’s patchwork pandemic response has led to wide disparities in data reporting, and even in definitions for basic medical concepts. In the absence of federal standards, states have adopted divergent and sometimes scientifically questionable approaches to disease control, which experts say have allowed the virus to spread.